View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13281_low_19 (Length: 264)
Name: NF13281_low_19
Description: NF13281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13281_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 22 - 241
Target Start/End: Complemental strand, 4997225 - 4997006
Alignment:
| Q |
22 |
agaaatgaaggtgggagcagggtagcatggaatgtgaggaaatagcattaccaagaaaattggtagcaagtgaaagattttggagtgttggaatatgaca |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4997225 |
agaaatgaaggtgggagcagggtagcatggaatgtgaggaaatagcattaccaagaaaattcgtagcaagtgaaagattttggagtgttggaatatgaca |
4997126 |
T |
|
| Q |
122 |
gaaattagatggaaaatcaccataaataccggtttctgtgaggtcgattgatacaacggatttattccacgaatcgcaggttatgcctctccagttacaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4997125 |
gaaattagatggaaaatcaccataaataccggtttctgtgaggtcgattgatacaacggatttattccgcgaatcgcaggttatgcctctccagttacaa |
4997026 |
T |
|
| Q |
222 |
ggattatgatctgtgtttgg |
241 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
4997025 |
ggattatgatctgtgtttgg |
4997006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University