View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13282_high_24 (Length: 267)
Name: NF13282_high_24
Description: NF13282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13282_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 9 - 223
Target Start/End: Complemental strand, 42224691 - 42224478
Alignment:
| Q |
9 |
aattattcttatacgaggacaataaatgttgaagttatgaaaaaattaaggaagcgctaaatattttatcatatttaagannnnnnnnattgatttgtgc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42224691 |
aattattcttatacgaggacaataaatgttgaagttatgaaaaaattaaggaagcactaaatattttatcatatttaagattttttttattgatttgtgc |
42224592 |
T |
 |
| Q |
109 |
ctgtaatgccatgttggggcaagaattttctctcnnnnnnnnnctaggttaaagaagaatatggctcttgtatgctttgtgtacatttcccttgtttaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42224591 |
ctgtaatgccatgttggggcaagaattttctctc-ttttttttctaggttaaagaagaatatggctcttgtatgctttgtgtacatttcccttgtttaat |
42224493 |
T |
 |
| Q |
209 |
tgaataattgtattg |
223 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
42224492 |
tgaataattgtattg |
42224478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University