View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13282_low_24 (Length: 267)
Name: NF13282_low_24
Description: NF13282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13282_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 12 - 245
Target Start/End: Complemental strand, 42224070 - 42223837
Alignment:
| Q |
12 |
atcatcaaacaaacacttaatcttaattttttgtttggaagcgtttttattgaatttgaagtatttgataaaatttactattgctttgcagaaactggtg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42224070 |
atcatcaaacaaacacttaatcttaatttttggtttggatgcgtttttattgaatttgaagtatttgataaaatttactattgctttgcagaaactggtg |
42223971 |
T |
 |
| Q |
112 |
atcatgactaaaagcattgagtacatgccgctctccatatctcttgcttcctttggaaatggtgtggcttggacaacttactctctcctccctttcgaca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42223970 |
atcatgactaaaagcattgagtacatgccgctctccatatctcttgcttcctttggaaatggtgtggcttggacaacttactctctcctccctttcgaca |
42223871 |
T |
 |
| Q |
212 |
aattcatcactgtaaacaagctaaatccttttgc |
245 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
42223870 |
aattcatcactgtaaacaaactaaatccttttgc |
42223837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 97 - 185
Target Start/End: Original strand, 36675871 - 36675959
Alignment:
| Q |
97 |
ttgcagaaactggtgatcatgactaaaagcattgagtacatgccgctctccatatctcttgcttcctttggaaatggtgtggcttggac |
185 |
Q |
| |
|
||||||||||| ||||||| ||||||||| |||||| ||||||| | | | ||||| | ||||| ||||| |||||||| ||||||| |
|
|
| T |
36675871 |
ttgcagaaactagtgatcaagactaaaagtgttgagttcatgccgtttttcctatctttagcttcatttggcaatggtgtttcttggac |
36675959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 97 - 185
Target Start/End: Original strand, 36685953 - 36686041
Alignment:
| Q |
97 |
ttgcagaaactggtgatcatgactaaaagcattgagtacatgccgctctccatatctcttgcttcctttggaaatggtgtggcttggac |
185 |
Q |
| |
|
||||||||||| ||||||| ||||||||| |||||| ||||||| | | | ||||| | ||||| ||||| |||||||| ||||||| |
|
|
| T |
36685953 |
ttgcagaaactagtgatcaagactaaaagtgttgagttcatgccgtttttcctatctttagcttcatttggcaatggtgtttcttggac |
36686041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University