View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13282_low_26 (Length: 253)
Name: NF13282_low_26
Description: NF13282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13282_low_26 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 8 - 253
Target Start/End: Complemental strand, 35762380 - 35762135
Alignment:
| Q |
8 |
gagcagagaagtaacctagtcatattaaccatggctatggtggataaaaacactacaatgtattaccaatttggtgtaggaaacaagtaatatagatgct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35762380 |
gagcagagaagtaacctagtcatattaaccatggctatggtggataaaaacactacaatgtattaccaatttggtgtaggaaacaagtaatatagattct |
35762281 |
T |
 |
| Q |
108 |
ttgannnnnnnaaccatgtagtctttgattcgttatcggttgatgcgtatagaaaaatatatgagatatgtaaatattattcaatcccaaattaatggat |
207 |
Q |
| |
|
|||| ||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35762280 |
ttgatttttttaaccatgtagtctttgattcgttattggctgatgcgtatagaaaaatatatgagatatgtaaatattattcaatcccaaattaatggat |
35762181 |
T |
 |
| Q |
208 |
ttgatgaagatgatacaacaaaatgtgggtttattccaagttaaac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35762180 |
ttgatgaagatgatacaacaaaatgtgggtttattccaagttaaac |
35762135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University