View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13283_high_1 (Length: 483)
Name: NF13283_high_1
Description: NF13283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13283_high_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 418 - 465
Target Start/End: Complemental strand, 2932038 - 2931992
Alignment:
| Q |
418 |
gaacaaaacatttggatggtgcagcaaaccagttttttatgccagaaa |
465 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
2932038 |
gaacaaaacatttagatg-tgcagcaaaccagttttttatgccagaaa |
2931992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University