View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13283_low_4 (Length: 257)
Name: NF13283_low_4
Description: NF13283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13283_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 14 - 244
Target Start/End: Original strand, 47583029 - 47583259
Alignment:
| Q |
14 |
aggggaaaatatcaaattgtattagattagacatgggaaaattagcggtattaatactggtgtgtttgattgcagcaacgattgcagaacaatgcggtag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47583029 |
aggggaaaatatcaaattgtattagattagacatgggaaaattagcggtattaatactggtgtgtttgattgcagcaacgattgcagaacaatgcggtag |
47583128 |
T |
 |
| Q |
114 |
acaagctggaggaaaaacatgtccaaacaacctttgttgcagccaatacggttactgtggtaccacagatgaatactgtggtccgaactgtcagagtaac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47583129 |
acaagctggaggaaaaacatgtccaaacaacctttgttgcagccaatacggttactgtggtaccacagatgaatactgtggtccgaactgtcagagtaac |
47583228 |
T |
 |
| Q |
214 |
tgtcatggcagtagtggtggtggtgaaagtg |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
47583229 |
tgtcatggcagtagtggtggtggtgaaagtg |
47583259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University