View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13285_high_15 (Length: 307)
Name: NF13285_high_15
Description: NF13285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13285_high_15 |
 |  |
|
| [»] scaffold0161 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 10 - 290
Target Start/End: Complemental strand, 32465495 - 32465208
Alignment:
| Q |
10 |
attatactctctcactctctccctcttcatctcaaaaatgcataaatcattaatgggaa-------gcatgttgcatgattaaatgcgacttggaagtag |
102 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32465495 |
attatactctctcattctctccctcttcatctcaaaaatgcataaatcattaatgggaattgggaagcatgttgcatgattaaatgcgacttggaagtag |
32465396 |
T |
 |
| Q |
103 |
tagtggtggtagtattggcaaggaccccatagccctagcaaccctcctaagcacatgtttttgaatctttccggttgaagtctttggcaactcttcctta |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
32465395 |
tagtggtggtagtattggcaaggaccccatagccctagcaacccttctaagcacatgtttttgaatctttccagttgaagtctttggcaactcctcctta |
32465296 |
T |
 |
| Q |
203 |
aacacaaccgtcttaggcaccataaaatgtggcaacttctctctacaaaactctttaacctccttctccgtcggtatctcctcttcct |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32465295 |
aacacaaccgtcttaggcaccataaaatgtggcaacttctctctacaaaactccttaacctccttctccgtcggtatctcctcttcct |
32465208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 138 - 260
Target Start/End: Original strand, 32455775 - 32455897
Alignment:
| Q |
138 |
tagcaaccctcctaagcacatgtttttgaatctttccggttgaagtctttggcaactcttccttaaacacaaccgtcttaggcaccataaaatgtggcaa |
237 |
Q |
| |
|
|||||||| | ||||||||||||||||||| |||||||||||| ||||||||||| || | | ||||||||| || ||||||| ||||||||| ||||| |
|
|
| T |
32455775 |
tagcaacctttctaagcacatgtttttgaacctttccggttgatgtctttggcaattccttcataaacacaattgttttaggcatcataaaatgcggcaa |
32455874 |
T |
 |
| Q |
238 |
cttctctctacaaaactctttaa |
260 |
Q |
| |
|
||||||| |||||||||| |||| |
|
|
| T |
32455875 |
cttctctttacaaaactccttaa |
32455897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0161 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: scaffold0161
Description:
Target: scaffold0161; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 138 - 254
Target Start/End: Complemental strand, 24790 - 24674
Alignment:
| Q |
138 |
tagcaaccctcctaagcacatgtttttgaatctttccggttgaagtctttggcaactcttccttaaacacaaccgtcttaggcaccataaaatgtggcaa |
237 |
Q |
| |
|
|||||||| | |||||||||||||||| || |||||||||||||||||||||||| || | | | | ||||| || |||||| ||||||||||||||| |
|
|
| T |
24790 |
tagcaacctttctaagcacatgttttttaacctttccggttgaagtctttggcaattccttcatgatcacaattgttttaggcgtcataaaatgtggcaa |
24691 |
T |
 |
| Q |
238 |
cttctctctacaaaact |
254 |
Q |
| |
|
|| ||| |||||||||| |
|
|
| T |
24690 |
ctcctccctacaaaact |
24674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University