View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13285_low_18 (Length: 272)
Name: NF13285_low_18
Description: NF13285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13285_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 253
Target Start/End: Complemental strand, 47853141 - 47852907
Alignment:
| Q |
18 |
atgaaatagtggtggaattgtgattttgttgaagttatgaaatgtagcttttgtaataattatggttgtaacgtgattctgctaaagtcactttcaaacc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
47853141 |
atgaaatagtggtggaattgtgattttgttgaagttatgaaatgtagcttttgtaataattatggttgtaacgtgattctgctaaagtcactttcaaatc |
47853042 |
T |
 |
| Q |
118 |
cgtctatccaatcacgcacttataaatgcatatgaagcacaaacacataaatcacacacctgacactggtaataatttgagtgatcgaatgtgattcatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47853041 |
cgtctatccaatcacgcacttataaatgcatatgaagcacaaacacataaatcacacacc-gacactggtaataatttgagtgatcgaatgtgattcatt |
47852943 |
T |
 |
| Q |
218 |
ttaatcgccttgtttttaactaatgtacctaatgct |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
47852942 |
ttaatcgccttgtttttaactaatgtacctaatgct |
47852907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University