View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13285_low_21 (Length: 252)
Name: NF13285_low_21
Description: NF13285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13285_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 14 - 233
Target Start/End: Original strand, 44262568 - 44262787
Alignment:
| Q |
14 |
aagaatattggtttgttatgccattaattgatgggatgtatgtgtatctttaagtcccatttcagttatcggatggataggaatagaattactctaatct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44262568 |
aagaatattggtttgttatgccattaattgatgggatgtatgtgtatctttaagtcccatttcagttatcggatggataggaatagaattactctaatct |
44262667 |
T |
 |
| Q |
114 |
tcgcaagtagttatcgaatggataagtatagaatacatggcctgctttcattcctacaagcattaggacagtctggtttggcatgactactgcaattgct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44262668 |
tcgcaagtagttatcgaatggataagtatagaatacatggcctgctttcattcctacaagcattaggacagtctggtttggcatgactactgcaattgtt |
44262767 |
T |
 |
| Q |
214 |
gttgttctgtttgtgtagtt |
233 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44262768 |
gttgttctgtttgtgtagtt |
44262787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University