View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13287_high_3 (Length: 420)
Name: NF13287_high_3
Description: NF13287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13287_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 385; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 385; E-Value: 0
Query Start/End: Original strand, 19 - 411
Target Start/End: Original strand, 8656071 - 8656463
Alignment:
| Q |
19 |
cctgttgttgatgataggtatttatttgtttaactgagtcctgtctctgttaattttgtcaaaggggatgttacccgcaaagaggatgttgaaagggtac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8656071 |
cctgttgttgatgataggtatttatttgtttaactgagtcctgtctctgttaattttgtcaaaggggatgttacccgcaaagaggatgttgaaagggtac |
8656170 |
T |
 |
| Q |
119 |
tccgtggtgctgactgcgtattccaccttgccgcctttgggatgtcaggaaaagagatgctgcaatttggtcgagttgatgaagtcaatataaacgggac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8656171 |
tccgtggtgctgactgcgtattccaccttgctgcctttgggatgtcaggaaaagagatgctgcaatttggtcgagttgatgaagtcaatataaacgggac |
8656270 |
T |
 |
| Q |
219 |
atgccatatactcgacgcttgcattgaccttggtatcaaaaggcttgtttattgtagcacatacaatgttgtctttggtggtcaaaagatacttaacgga |
318 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8656271 |
atgccatatactcgatgcttgcattgaccttggtatcaaaaggcttgtttattgtagcacatacaatgttgtctttggtggtcaaaagatacttaacgga |
8656370 |
T |
 |
| Q |
319 |
aatgaggctttgccgtatttcccaattgatcgtcacgttgatccatacagccgcagtaaatcaattgctgaacagttggttctaaagaataat |
411 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8656371 |
aatgaggctttgccgtatttcccaattgatcgtcacgttgatccatacagccgcagtaaatcaattgctgaacagttggttctaaagaataat |
8656463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University