View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13287_high_4 (Length: 382)
Name: NF13287_high_4
Description: NF13287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13287_high_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 1 - 365
Target Start/End: Original strand, 34019001 - 34019346
Alignment:
| Q |
1 |
catcactaatcatccttgtggttacaaaattatgaagaggttgtgaactacttgcaatgtcatgtagaacataaaaagaagagagcgcaaaagtttgaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34019001 |
catcactaatcatccttgtggttacaaaattatgaagaggttgtgaactacttgcaatgtcatgtagaacataaaaagaagagagcgcaaaagtttgaga |
34019100 |
T |
 |
| Q |
101 |
ggtatctcaaagcactatattggataatctcacatactataaggaatagaataatccaattttggtgaatcatgataactttcttgtcattctctatcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34019101 |
ggtatctcaaagcactatattggataatctcacatactataaggaatagaataatccaattttggtgaatcatgataactttcttgtcattctctatcct |
34019200 |
T |
 |
| Q |
201 |
caatttattcattgtaaaagataataagcatacacatacacttatactcgtcctatattaaatttagtttaatacatacttgatacttcttctgatactt |
300 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34019201 |
caatttattcactgtaaaagataataagcatacacatacacttatactcgtcctatattaaatttagtttaatacatacttg------------------ |
34019282 |
T |
 |
| Q |
301 |
gatacttcaaattcacaaatttgaatcacttctcaaagttgagatcaagccaaaaatttcaaaat |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34019283 |
-atacttcaaattcacaaatttgaatcacttctcaaagttgagatcaagccaaaaatttcaaaat |
34019346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University