View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13287_low_14 (Length: 287)
Name: NF13287_low_14
Description: NF13287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13287_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 264; Significance: 1e-147; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 11 - 274
Target Start/End: Original strand, 11315515 - 11315778
Alignment:
| Q |
11 |
cagagaggtggttgtcattggatgggacaacgttcatcatgcatgactctttcaagtttgttgcattcaatgctggtcctagaatatgtttggggaagga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11315515 |
cagagaggtggttgtcattggatgggacaacgttcatcatgcatgactctttcaagtttgttgcattcaatgctggtcctagaatatgtttggggaagga |
11315614 |
T |
 |
| Q |
111 |
cttggcataccttcagatgaagtctattgctgctgctgtgcttctccgtcatcgccttgcggtggttcctggccaccgggtggagcaaaagatgtcactc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11315615 |
cttggcataccttcagatgaagtctattgctgctgctgtgcttctccgtcatcgccttgcggtggttcctggccaccgggtggagcaaaagatgtcactc |
11315714 |
T |
 |
| Q |
211 |
accttgttcatgaaaaatggtctcagggttaatgtttacaatagggatttgaagggtgtttttg |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11315715 |
accttgttcatgaaaaatggtctcagggttaatgtttacaatagggatttgaagggtgtttttg |
11315778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 58 - 164
Target Start/End: Complemental strand, 41065112 - 41065006
Alignment:
| Q |
58 |
tctttcaagtttgttgcattcaatgctggtcctagaatatgtttggggaaggacttggcataccttcagatgaagtctattgctgctgctgtgcttctcc |
157 |
Q |
| |
|
|||| |||||||||| | || ||||| || || || || |||||||||||||| || || || | ||||||||||| |||||||||||||||||||| | |
|
|
| T |
41065112 |
tcttacaagtttgtttcgtttaatgcggggccaaggatttgtttggggaaggatttagcttatttgcagatgaagtccattgctgctgctgtgcttctgc |
41065013 |
T |
 |
| Q |
158 |
gtcatcg |
164 |
Q |
| |
|
| ||||| |
|
|
| T |
41065012 |
gccatcg |
41065006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 149
Target Start/End: Original strand, 25244227 - 25244312
Alignment:
| Q |
64 |
aagtttgttgcattcaatgctggtcctagaatatgtttggggaaggacttggcataccttcagatgaagtctattgctgctgctgt |
149 |
Q |
| |
|
|||||||| || || |||||||| || || | ||||| |||||||| ||||| |||||||| ||||| ||| ||||||||||||| |
|
|
| T |
25244227 |
aagtttgtggcttttaatgctggaccgaggacttgtttagggaaggatttggcttaccttcaaatgaaatctgttgctgctgctgt |
25244312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University