View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13287_low_17 (Length: 275)
Name: NF13287_low_17
Description: NF13287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13287_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 133 - 259
Target Start/End: Complemental strand, 40582769 - 40582643
Alignment:
| Q |
133 |
gatggaacttagcaagggacaccaacaccattgtttctggtgatagtaacccttcctattataaagttaatgttcaggtgttaggacattgagcttccac |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40582769 |
gatggaacttagcaagggacaccaacaccattgtttctggtgatagtaacccttcctattataaagttcatgttcaggtgttaggacattgagcttccac |
40582670 |
T |
|
| Q |
233 |
gccaataacaggtgtgctggtaaaatt |
259 |
Q |
| |
|
|||||||||| ||||||||||||||| |
|
|
| T |
40582669 |
gccaataacaattgtgctggtaaaatt |
40582643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 10 - 70
Target Start/End: Complemental strand, 40582892 - 40582832
Alignment:
| Q |
10 |
tcgaagaaaataatatctatcggctaaaaatggtacttatatttagatgtttgacacacgt |
70 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40582892 |
tcgaataaaataatatctatcggctaaaaatggtacttatatttagatgtttgacacacgt |
40582832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University