View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13287_low_20 (Length: 250)
Name: NF13287_low_20
Description: NF13287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13287_low_20 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 8656697 - 8656459
Alignment:
| Q |
13 |
aatatcccacgttttaatttcactttgattgtaatgcttactctttcttaagaggagacaaagatctgtatgtatactaacgattactcatacgtattca |
112 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8656697 |
aatatcccacattttaatttcactttgattgtaatgcttactctttcttaagaggagacaaagatctgtatgtatactaacgattactcatacgtattca |
8656598 |
T |
 |
| Q |
113 |
tttatcattctctacaaaaagttggtgaaagatttatcactcattcccaccaaacacccaaagagagccttaattttgatagagcatagattaatgataa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8656597 |
tttatcattctctacaaaaagttggtgaaagatttatcactcattcccaccaaacacccaaagagagccttaattttgatagagcatagattaatgataa |
8656498 |
T |
 |
| Q |
213 |
taagagtaaaagt-aattacttgagagtgcgggcattat |
250 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8656497 |
taagagtaaaagtaaattacttgagagtgcgggcattat |
8656459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University