View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13288_high_10 (Length: 310)
Name: NF13288_high_10
Description: NF13288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13288_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 1e-35; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 54 - 206
Target Start/End: Original strand, 38038353 - 38038528
Alignment:
| Q |
54 |
tcactttgggacactcgcatttagaacgctgcttaaatgtaataatcttg--------------------tttgtttgtttaggttttgcttagggaaaa |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38038353 |
tcactttgggacactcgcatttagaacgctgcttaaatgtaataatcttgttgtagcttcttctgacttgtttgtttgtttaggttttgcttagggaaaa |
38038452 |
T |
|
| Q |
134 |
tcagtttcttgctgtgtcccctttccttg---gtagtagtactatgttttcttatgtgactcaaaatcttgttgtt |
206 |
Q |
| |
|
||| |||||||||||||||||||||| || ||||||||| |||||||||||||||||||| | ||||||||||| |
|
|
| T |
38038453 |
tcactttcttgctgtgtcccctttccctggtagtagtagtagtatgttttcttatgtgactcgatatcttgttgtt |
38038528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 2 - 55
Target Start/End: Original strand, 54751823 - 54751876
Alignment:
| Q |
2 |
cgctcattctctgccgctcgccgctcgctcaactccgattaaccttcaggtttc |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54751823 |
cgctcattctctgccgctcgccgctcgctcaactccgattaaccttcaggtttc |
54751876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 246 - 298
Target Start/End: Original strand, 38038530 - 38038582
Alignment:
| Q |
246 |
tgttctgttctgttcttatgctgttaattgtgcaattgatacatgctgtttga |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38038530 |
tgttctgttctgttcttatgctgttaattgtgcaattgatacatgctgtttga |
38038582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 2 - 54
Target Start/End: Complemental strand, 30410866 - 30410814
Alignment:
| Q |
2 |
cgctcattctctgccgctcgccgctcgctcaactccgattaaccttcaggttt |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30410866 |
cgctcattctctgccgctcgccgctcgctcaactccgattaaccttcaggttt |
30410814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 4 - 55
Target Start/End: Original strand, 18022258 - 18022309
Alignment:
| Q |
4 |
ctcattctctgccgctcgccgctcgctcaactccgattaaccttcaggtttc |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18022258 |
ctcattctctgccgctcgccgctcgctcaactccgattaacctttaggtttc |
18022309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 4 - 55
Target Start/End: Complemental strand, 9179952 - 9179901
Alignment:
| Q |
4 |
ctcattctctgccgctcgccgctcgctcaactccgattaaccttcaggtttc |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9179952 |
ctcattctctaccgctcgccgctcgctcaactccgattaaccttcaggtttc |
9179901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 22 - 55
Target Start/End: Original strand, 3925839 - 3925872
Alignment:
| Q |
22 |
ccgctcgctcaactccgattaaccttcaggtttc |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
3925839 |
ccgctcgctcaactccgattaaccttcaggtttc |
3925872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 242
Target Start/End: Original strand, 39452665 - 39452705
Alignment:
| Q |
202 |
ttgttgttatacaagtattatcgctacttgttttgttaatt |
242 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
39452665 |
ttgttgttatacaagtattatcactgtttgttttgttaatt |
39452705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University