View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13288_high_15 (Length: 259)
Name: NF13288_high_15
Description: NF13288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13288_high_15 |
 | |
|
| [»] scaffold0024 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0024 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 89 - 244
Target Start/End: Complemental strand, 80271 - 80116
Alignment:
| Q |
89 |
atcatattatatgtgttttcttccaagatattattaaatgtgaataatgcaaatcatgtgatctttttggcccacagtagaagagcattcatttctgttt |
188 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
80271 |
atcatattatatgtgttttcttccaatatattattaaatgtgattaatgcaaatcatgtgacctttttggcccacactagaagagcattcatttctgttt |
80172 |
T |
|
| Q |
189 |
cgaatttttgcctatgaatattaattagtgtatannnnnnncctagctgaagtgtt |
244 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
80171 |
cgaatttttgcctacgaatattaattagtgtatatttttttcctagctgaagtgtt |
80116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 5 - 70
Target Start/End: Complemental strand, 80322 - 80257
Alignment:
| Q |
5 |
gagagaaaagaataattaaaactgataggcacgttttcttaaggagtcattatcatattatatgtg |
70 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
80322 |
gagagaaaagaataattaaaattgataggtacgttttcttaaggagtcattatcatattatatgtg |
80257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University