View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13288_high_19 (Length: 235)
Name: NF13288_high_19
Description: NF13288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13288_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 21 - 223
Target Start/End: Complemental strand, 10557241 - 10557039
Alignment:
| Q |
21 |
aaacctggtagagctccttcattgtaccttctctttgcttcttttctacactctagtgcatactttatatggtttctgaactcacgttgcaaatcagcaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10557241 |
aaacctggtagagctccttcattgtaccttctctttgcttcttttctacactctagtgcatactttatatggtttctgaactcacgttgcaaatcagcaa |
10557142 |
T |
 |
| Q |
121 |
caaatttcaaagcatctttggttagaatttttgcaaactctgcatcatatcttcccctaacttcgacaccttctggtgcgtcgtagttagagatgatatt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
10557141 |
caaatttcaaagcatctttggttagaatttttgcaaactctgcatcatatcttcccctaacttcgacgccttctggtgcatcgtagttagagatgatatt |
10557042 |
T |
 |
| Q |
221 |
ctt |
223 |
Q |
| |
|
||| |
|
|
| T |
10557041 |
ctt |
10557039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University