View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13288_low_16 (Length: 254)

Name: NF13288_low_16
Description: NF13288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13288_low_16
NF13288_low_16
[»] chr1 (1 HSPs)
chr1 (1-245)||(32525924-32526168)


Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 32525924 - 32526168
Alignment:
1 ttgttgcagcacgtgagcttctcgatggattgacttaccctattgatgttgcttggaatgctatgatttctggttatgttcaccgtggtttatatgaaga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||    
32525924 ttgttgcagcacgtgagcttctcgatggattgacttaccctattgatgttgcttggaatgctatgatttctggttatgttcgtcgtggtttatatgaaga 32526023  T
101 ggcatttgacacgtttagaagaatgcattcaatgggaattcaggaggatgagtatacttacaccagtttgattagtgcttgtggttcttgtaatgagaaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32526024 ggcatttgacacgtttagaagaatgcattcaatgggaattcaggaggatgagtatacttacaccagtttgattagtgcttgtggttcttgtaatgagaaa 32526123  T
201 atggggatgttcaattatggaagacaggtgcatggttatattctt 245  Q
    |||||||||||||||| ||||||||||||||||||||||||||||    
32526124 atggggatgttcaattgtggaagacaggtgcatggttatattctt 32526168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University