View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13288_low_18 (Length: 247)
Name: NF13288_low_18
Description: NF13288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13288_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 37409012 - 37408802
Alignment:
| Q |
18 |
ttctcatcatgggacttcaccgatgatccctgcaacttcgccggcgtttactgcgccaccgataaagtcattgcactcagtctaggagaatctagagccg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37409012 |
ttctcatcatgggacttcaccgatgatccctgcaacttcgccggcgtttactgcgccaccgataaagtcattgcactcagtctaggagaatctagagccg |
37408913 |
T |
 |
| Q |
118 |
gttcacctggcctcacaggaaaaatcgacatcgccatcggaaaactctcgtctctcgtagatttaaccgtttctccggggagaatttacggtcatctccc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37408912 |
gttcacctggcctcacaggaaaaatcgacaccgccatcggaaaactctcgtctctcgtagatttaaccgtttctccggggagaatttacggtcatctccc |
37408813 |
T |
 |
| Q |
218 |
tcagtccattt |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
37408812 |
tcagtccattt |
37408802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University