View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1328_high_17 (Length: 252)
Name: NF1328_high_17
Description: NF1328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1328_high_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 87 - 240
Target Start/End: Original strand, 33890137 - 33890290
Alignment:
| Q |
87 |
tgagacattatttctagagatttgagaaagaatttgctgcaacaagttatgttcttcagaggtttttaaagactcatggtgagccaacttttcaacatca |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33890137 |
tgagacattatttctagagatttgagaaagaatttgctgcaacaagttatgttctttagaggtttttaaagactcatggtgagccaaattttcaacatca |
33890236 |
T |
 |
| Q |
187 |
taactattaatgattttaataattttttattaccaataatgtcactaatatatt |
240 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33890237 |
taactattaatgattttaataactttttattaccaataatgtcactaatatatt |
33890290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University