View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1328_low_12 (Length: 319)
Name: NF1328_low_12
Description: NF1328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1328_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-138; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 48 - 311
Target Start/End: Complemental strand, 43230949 - 43230686
Alignment:
| Q |
48 |
cataacatactcatcatcgtagtctcagaaaatggaaattgaagcaaggcaaggcgtggtggcaaagaagctatggaacatggtacgtgtattattgttc |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43230949 |
cataacatactcatcatcgtagtctcagaaaatggaaattgaagcaaggcaaggcgtggtggcaaagaagctatggaacatggtacgtgtattattgttc |
43230850 |
T |
|
| Q |
148 |
attataagaaaaggcatagccaagagcaaaacaatggtagacctcaatttaattctcaaacgtgggaaacttgctggaaaagcattaatcaatactctca |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43230849 |
attataagaaaaggcatagccaagagcaaaacaatggtacacctcaatttgattctcaaacgtgggaaacttgctggaaaagcattaatcaatactctca |
43230750 |
T |
|
| Q |
248 |
tgctcaaccatcaattttatcattcttccttcacatgtcgctctgacaacaactcattcatctc |
311 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43230749 |
tgctcaaccatcaactttatcattcttccttcacatgtcgctccgacaacaactcattcatctc |
43230686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 76 - 143
Target Start/End: Complemental strand, 43235240 - 43235173
Alignment:
| Q |
76 |
aaaatggaaattgaagcaaggcaaggcgtggtggcaaagaagctatggaacatggtacgtgtattatt |
143 |
Q |
| |
|
|||||| |||||| ||||||||||| | | || |||||||||||||||||||||||| |||||||||| |
|
|
| T |
43235240 |
aaaatgaaaattggagcaaggcaagacatcgtagcaaagaagctatggaacatggtaagtgtattatt |
43235173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University