View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1328_low_13 (Length: 305)
Name: NF1328_low_13
Description: NF1328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1328_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 70 - 253
Target Start/End: Complemental strand, 19058636 - 19058453
Alignment:
| Q |
70 |
aatcatttctgtacttttcacttcacaagtctatgccatcactttttcttgatatattatattatcattttcatataaaatatgaagagtctatttactc |
169 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
19058636 |
aatcatttctgcacttttcacttcacaagtctatgccatcactttttctatatatattatattatcattttcatataaaatatgaagagtctatttaccc |
19058537 |
T |
 |
| Q |
170 |
ttttaatgtttgtcacaacttcacaatgcttgtgtggtagaataacacctgacgatggttctaactttaatgttcttacctatg |
253 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19058536 |
ttttaatgtttgtcataacttcacaatgcttgtgtggtagaataacacctgacgatggttctaactttaatgttcttacatatg |
19058453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University