View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1328_low_14 (Length: 297)
Name: NF1328_low_14
Description: NF1328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1328_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 27 - 276
Target Start/End: Complemental strand, 52396637 - 52396385
Alignment:
| Q |
27 |
caataaacaaagaaataaaatggcggtagcacacggtggttacgacggtgaaatcggtggctacaattctcgtctaatcccatcaataaaaccagagtta |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52396637 |
caataaacaaagaaataaaatggcggtagcacacggtggttacgacggtgaaatcggtggctacaattctcgtctaatcccatcaataaaaccagagtta |
52396538 |
T |
 |
| Q |
127 |
ttcaatgacagtgcaaattccagctcttacacctacgacgacgtttcaaccgaaagaaaagaatcagtacttaccgaagaagaa---gaaggtgctacag |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
52396537 |
ttcaatgacagtgcaaattccagctcttacacctacgacgacgtttcaaccgaaagaaaagaatcagtactaaccgaagaagaagaagaaggtgctacag |
52396438 |
T |
 |
| Q |
224 |
cttctcacgcaattcatatcaaagaagaagttcttgaagaagacgacggtgct |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52396437 |
cttctcacgcaattcatatcaaagaagaagttcttgaagaagacgacggtgct |
52396385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University