View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1328_low_20 (Length: 262)
Name: NF1328_low_20
Description: NF1328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1328_low_20 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 30 - 262
Target Start/End: Complemental strand, 33082171 - 33081938
Alignment:
| Q |
30 |
gttaggtcttggagacttgcttaaattagacaaaacatcaatgttcgtagaaccctagcaaatatatttattcaccaatgagattgtcaaatcaacaatg |
129 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| | ||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33082171 |
gttaggtcttggagacttgcttgaattagacaaaacatcaatgttggcagaacgctagcaaatatatttatccaccaatgagattgtcaaatcaacaatg |
33082072 |
T |
 |
| Q |
130 |
gaatttaaatttatatcatagtaagatctaatctgaata-tttatcaattggtttgatctacgaataacggtaaacgagatatttttaagcatgggtaat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33082071 |
gaatttaaatttatatcatagtaagatctaacctgaatattttatcaattggtttgatctacgaataacggtaaacgagatatttttaagcatgggtaat |
33081972 |
T |
 |
| Q |
229 |
taatttccctatactttataaatctaaaatcacc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
33081971 |
taatttccctatactttataaatctaaaatcacc |
33081938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University