View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13292_low_12 (Length: 368)
Name: NF13292_low_12
Description: NF13292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13292_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 11 - 349
Target Start/End: Complemental strand, 32848679 - 32848341
Alignment:
| Q |
11 |
cacagatcaaacttcttcggttacatcacagatgaaaatgtgaaactgaaatcgatgattgaattacctgaggtaacgagaaacgaggttgatgaatccg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32848679 |
cacagatcaaacttcttcggttacatcacagatgaaaatgtgaaactgaaatcgatgattgaattacctgaggtaacgagaaacgaggttgatgaatccg |
32848580 |
T |
 |
| Q |
111 |
gttttctcattctcgctgcaaaaacaacacatatcagatttgaaatcttagatcatgnnnnnnnnnnnnnnnctcaaacagtttcgatgattatcgatga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
32848579 |
gttttctcattctcgctgcaaaaacaacacatatcagatttgaaatcttagatcatgaaaaaattgaaaaaactctaacagtttcgatgattatcgatga |
32848480 |
T |
 |
| Q |
211 |
aattgagaaaatgcgaacctgatttgatccaatccagtaacagcggatttgagattggcgagattggtttcggtagcggtagccattggcaatggaagat |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32848479 |
aattgagaaaatgcgaacctgatttgatccaatccagtaacagcggatttgagattggcgagattggtttcggtagcggtagccattggcgatggaagat |
32848380 |
T |
 |
| Q |
311 |
tctagagagaaaggaagatgcaaatgtgtgtgtggagag |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32848379 |
tctagagagaaaggaagatgcaaatgtgtgtgtggagag |
32848341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 75 - 130
Target Start/End: Original strand, 29056782 - 29056837
Alignment:
| Q |
75 |
tacctgaggtaacgagaaacgaggttgatgaatccggttttctcattctcgctgca |
130 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||| | ||||||||||| ||||| |
|
|
| T |
29056782 |
tacctgagataacgagcaacgaggttgatgaatccgttcttctcattctcactgca |
29056837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University