View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13292_low_13 (Length: 357)
Name: NF13292_low_13
Description: NF13292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13292_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 940242 - 939968
Alignment:
| Q |
1 |
cgtctttttcttcaaataaataaagtttattccaaattattatgagagnnnnnnnnnnnnn-cattttgaatgtacactttcagacgggatttgtctaga |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||||||||||||||| |
|
|
| T |
940242 |
cgtctttttcttcaaataaataaagtttattccaaattattatgagagctttttttttttctcactttgaatgtacactttcaaacgggatttgtctaga |
940143 |
T |
 |
| Q |
100 |
attatagctccggatggaatttatttaaaagtaaacttttgaagataatttcatcactctcactaaaattcacccactcctacactattttggtgcaacc |
199 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
940142 |
attatagctccggatggaatttgtctaaaagtaaacttttgaagataatttcatcactctcactaaaattcactcactcctacactattttggtgcaacc |
940043 |
T |
 |
| Q |
200 |
tattgttgagtatcatgattttggtgaacatttcattattgatcaagtttgtgtacaattatgacaactaatcat |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
940042 |
tattgttgagtatcatgattttggtgaacatttcattattgatcaagtttgtgtacaattatgacaactattcat |
939968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University