View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13292_low_15 (Length: 338)
Name: NF13292_low_15
Description: NF13292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13292_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 20 - 327
Target Start/End: Complemental strand, 2332486 - 2332181
Alignment:
| Q |
20 |
atgccaacaaattttgtaaaatatcggttgaaatccatcatgtcctagggctttgtaagagtgcatagggaaaatagaatctttaatcctttccatagtt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2332486 |
atgccaacaaattttgtaaaatatcggttgaaatccatcatgtcctagggctttgtaagagtgcatagggaaaatagaatctttaatcctttccatagtg |
2332387 |
T |
|
| Q |
120 |
acaggcaagagaagctggtccatcaagttaatgctaagagatggaatattatccagttgtaaactatatgagaggtttacagggatcatttgattggaat |
219 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2332386 |
acaggcaagagaagctggtccatcaagctaatgccaagagatggaatattatccagttgtaaactatatgagaggtttacagggatcatttgattgggat |
2332287 |
T |
|
| Q |
220 |
agattcataaaaaactttgaggcttcccttttgagagtgcttgcattcgtgcaccatatgttttccacattcaaaccagaaattttatttcgtcgtcttc |
319 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2332286 |
agatgcataaaaaactttgaggcttcccttttgagagtgcttgcattcgtgcacc--atgttttccacattcaaaccagaaattttatttcgccgtcttc |
2332189 |
T |
|
| Q |
320 |
tgatgatg |
327 |
Q |
| |
|
|||||||| |
|
|
| T |
2332188 |
tgatgatg |
2332181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University