View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13292_low_23 (Length: 239)
Name: NF13292_low_23
Description: NF13292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13292_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 107 - 221
Target Start/End: Complemental strand, 20518881 - 20518767
Alignment:
| Q |
107 |
catgattattcaagtatgaatctatgatgacacttgttttgcaacgtacatgcaattgtttattagttgtcactgtttagttacacacgttttcattata |
206 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20518881 |
catgattttttaagtatgaatctatgatgacacttgttttgcaacgtacatgcaattgtttattagttgtcactgtttagttgcacacgttttcattata |
20518782 |
T |
|
| Q |
207 |
ctatttcacgtggat |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
20518781 |
ctatttcacgtggat |
20518767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 13 - 67
Target Start/End: Complemental strand, 20518976 - 20518922
Alignment:
| Q |
13 |
tgtttgtttgttactgctgctaaaatctaaatatttgtaggtggatgaaaccaaa |
67 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20518976 |
tgtttgtttgttgctgctgctaaaatctaaatatttgtaggtggatgaaaccaaa |
20518922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University