View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13292_low_25 (Length: 234)
Name: NF13292_low_25
Description: NF13292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13292_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 34390816 - 34391041
Alignment:
| Q |
1 |
agtccactttgtctagaa-ttgatggttagagaaaagacagccatgatcattgtagaagaaggtatgacatcatgggagatcattgaaatattggagaac |
99 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34390816 |
agtccactttgtctagaaattgatggttagagaaaagacagccatgatcattgtagaagaaggtatgacatcatgggagatcattgaaatattggagaac |
34390915 |
T |
 |
| Q |
100 |
tatttgatgtatgcaaattgcaatatnnnnnnnncggggcttgctagctaggacaaatttaaaaatgaaaataattgataatctttatc----taaattg |
195 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34390916 |
tatttgatgtatgcaaattgcaatataaaaaaaatggggcttgctagctaggacaaattttaaaatgaaaataattgataatctttatctaattaaattg |
34391015 |
T |
 |
| Q |
196 |
ttatttgatgtttcaatgtgttcatt |
221 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
34391016 |
ttatttgatgtttcaatgtgttcatt |
34391041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University