View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13292_low_27 (Length: 205)
Name: NF13292_low_27
Description: NF13292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13292_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 4e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 18 - 159
Target Start/End: Original strand, 28735447 - 28735588
Alignment:
| Q |
18 |
gaagtcgggctaaatctactgcaaatacttttaatatgatgcaattttttcttatgttggagattgtattttgcaggagaaagcacacagtgatttctac |
117 |
Q |
| |
|
|||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| | |
|
|
| T |
28735447 |
gaagtcaggataaatctactgcaaatacttttcatatgatgcaattttttcttatgttggagattgtattttgcaggagaaagcactcaaagatttctgc |
28735546 |
T |
 |
| Q |
118 |
ttatttgataggtaaagatgcatacttaatattcccatggtt |
159 |
Q |
| |
|
| |||||||||| |||||||| ||||||||||| ||| |||| |
|
|
| T |
28735547 |
taatttgatagggaaagatgcctacttaatatttccaaggtt |
28735588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 126 - 188
Target Start/End: Original strand, 28730842 - 28730904
Alignment:
| Q |
126 |
taggtaaagatgcatacttaatattcccatggtttactgtgttttacattttggttggttttc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28730842 |
taggtaaagatgcatacttaatattcccatggtttactgtgttttacattttggttggttttc |
28730904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University