View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13292_low_5 (Length: 462)
Name: NF13292_low_5
Description: NF13292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13292_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 3e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 20 - 226
Target Start/End: Complemental strand, 40290347 - 40290145
Alignment:
| Q |
20 |
aaagagatattacaattcatgtagaaactgtctgccgtaaggatgagatagtacgacccatgtctaaactgcttaccattacgaagagatcataccactt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40290347 |
aaagagatattacaattcatgtagaaactgtctgccgtaaggataagatagtacgacccatgtctaaactgtttaccattacgaagagatcataccactt |
40290248 |
T |
 |
| Q |
120 |
atgaattatgttctgt--atattgaacatcataagctacattaattaagagataattttgtatctcatgtggtaagtgctcacaatgtttctatatgtgt |
217 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40290247 |
atgaattatgttctgtacatattgaacatcataagctac---aattaagagataa---tgtatctcatgtggtaagtgctcacaatgtttctatatgtgt |
40290154 |
T |
 |
| Q |
218 |
gttgtttaa |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
40290153 |
gttgtttaa |
40290145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University