View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13293_high_6 (Length: 221)
Name: NF13293_high_6
Description: NF13293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13293_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 19 - 207
Target Start/End: Complemental strand, 31179329 - 31179143
Alignment:
| Q |
19 |
aacgtggccatcttaatcaaaatcaattggattgggaattcaaaaattgttgaacattgaccaattgactggaataaagctttggcgcacttaacttagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31179329 |
aacgtggccatcttaatcaaaatcaattggattgggaattcaaaaattgttgaacattgaccaattgactggaataaagctttggcgcacttaacttagt |
31179230 |
T |
 |
| Q |
119 |
gctggaccttcatcaagaatcagttcatattagaaatccattttcaattggatatatgttatttggtcacacatgttttggtttatatt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31179229 |
gctggaccttcatcaagaatcagttcatattagaaatccattttcaattggatatatgttatttggtcacacatg--ttggtttatatt |
31179143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University