View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13293_low_3 (Length: 278)
Name: NF13293_low_3
Description: NF13293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13293_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 13466351 - 13466583
Alignment:
| Q |
1 |
gaagcaaaggacacaatggacggcatcatagacacagtttcaggccctcattcactccacccattaattgaaatgttgaagacatgtggcaaattgattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13466351 |
gaagcaaaggacacaatggacggcatcatagacacagtttcaggccctcattcactctacccattaattgaaatgttgaagacatgtggcaaattaattt |
13466450 |
T |
 |
| Q |
101 |
tagttggtgcatcagttacacctcctatcttgccatatatgcctttaatgtctggtaaattataaataaccttgtaatgcttgataattatttttactct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13466451 |
tagttggtgcatcagttacacctcctatcttgccatatatgcctttaatgtctggtaaattataaataaccttgtaatgcttgataattattttaactct |
13466550 |
T |
 |
| Q |
201 |
tgattaatttctgcttggaactaattaagaatc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13466551 |
tgattaatttctgcttggaactaattaagaatc |
13466583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University