View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13293_low_5 (Length: 246)
Name: NF13293_low_5
Description: NF13293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13293_low_5 |
 | |
|
| [»] scaffold0001 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0001 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 5 - 144
Target Start/End: Complemental strand, 415753 - 415603
Alignment:
| Q |
5 |
tctcgaagaatatcaaatgaaacaatcataaattgtttgttcaaatttgaaagaata-----agaaagaaa------gaagaagccatataaatctccta |
93 |
Q |
| |
|
|||| ||||| |||||||||||| |||||||||||||||||||||||||||||||| || | | | |||||||||||| |||||||||| |
|
|
| T |
415753 |
tctctaagaaaatcaaatgaaactatcataaattgtttgttcaaatttgaaagaatggatctagtagggtatgtgtagaagaagccatacaaatctccta |
415654 |
T |
|
| Q |
94 |
ccataacaccaaaactcatattgttgtaaataaagtgcaatcaatgctatg |
144 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
415653 |
ccataactccaaaactcatattgttgtaaataaagtgcaatcaatgctatg |
415603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University