View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13294_high_2 (Length: 237)

Name: NF13294_high_2
Description: NF13294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13294_high_2
NF13294_high_2
[»] chr2 (1 HSPs)
chr2 (1-221)||(44199120-44199340)


Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 44199340 - 44199120
Alignment:
1 tgcgagcgaggccatagcccgaaacaccatctggggaacgaatggctttgagtttttggtgagagggaagggtgaagagagtttgtccaagccattgaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44199340 tgcgagcgaggccatagcccgaaacaccatctggggaacgaatggctttgagtttttggtgagagggaagggtgaagagagtttgtccaagccattgaat 44199241  T
101 ttcatcaaggaggcttattgggatgccatggttcaccacttgatacacaccccatgttttgcatgcatgtcctattaactttgaagcatttgggtcattg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44199240 ttcatcaaggaggcttattgggatgccatggttcaccacttgatacacaccccatgttttgcatgcatgtcctattaactttgaagcatttgggtcattg 44199141  T
201 agatcaataacgggaacaata 221  Q
    |||||||||||||||||||||    
44199140 agatcaataacgggaacaata 44199120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University