View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13294_low_1 (Length: 369)
Name: NF13294_low_1
Description: NF13294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13294_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 13 - 279
Target Start/End: Original strand, 44199392 - 44199658
Alignment:
| Q |
13 |
gatcccctcttgatcattttcaacatctttggcctcaagattattacaaacacgggtgagcgccattaagagtcttacattagatataatatactttgaa |
112 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| ||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44199392 |
gatcccctcttgatcattttcaacaactttggcctcaagattatgccaaacactggtgagtgccattaagagtcttacattagatataatatactttgaa |
44199491 |
T |
|
| Q |
113 |
aaatacttttcaagtaaaatattatttttcaacttatactcgtgtgatatcaagtattaggtctaacttaagttttaagatattccaaccatcttcttga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44199492 |
aaatacttttcaagtaaaatattatttttcaacttatactcgtgtgatatcaaatattaggtctaacttaagttttaagatattccaaccatctttttga |
44199591 |
T |
|
| Q |
213 |
tgtgtgtgtgatgtgtcctcaattcacatccaatgctacaaaaacaataattaagctaactaactac |
279 |
Q |
| |
|
| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44199592 |
tttgtgtgtgatgtgtcctcaattctcatccaatgctacaaaaacaataattaagctaactaactac |
44199658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University