View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13294_low_3 (Length: 237)
Name: NF13294_low_3
Description: NF13294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13294_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 44199340 - 44199120
Alignment:
| Q |
1 |
tgcgagcgaggccatagcccgaaacaccatctggggaacgaatggctttgagtttttggtgagagggaagggtgaagagagtttgtccaagccattgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44199340 |
tgcgagcgaggccatagcccgaaacaccatctggggaacgaatggctttgagtttttggtgagagggaagggtgaagagagtttgtccaagccattgaat |
44199241 |
T |
|
| Q |
101 |
ttcatcaaggaggcttattgggatgccatggttcaccacttgatacacaccccatgttttgcatgcatgtcctattaactttgaagcatttgggtcattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44199240 |
ttcatcaaggaggcttattgggatgccatggttcaccacttgatacacaccccatgttttgcatgcatgtcctattaactttgaagcatttgggtcattg |
44199141 |
T |
|
| Q |
201 |
agatcaataacgggaacaata |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
44199140 |
agatcaataacgggaacaata |
44199120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University