View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13295_high_21 (Length: 509)
Name: NF13295_high_21
Description: NF13295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13295_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 3 - 224
Target Start/End: Complemental strand, 39461320 - 39461099
Alignment:
| Q |
3 |
gatgtcgaagaatatatcccagaaaaagatctcaatgtttgaggaactaatccatatcaaggttttactttcattccaatccattcaaatttatcaattt |
102 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39461320 |
gatgtcgtcgaaaatatcccagaaaaagatctcaatgtttgaggaactaatccatatcaaggttttattttcattccaatccattcaaatttatcaattt |
39461221 |
T |
 |
| Q |
103 |
cacagctaggtgttggttgttttcattcacccaaatttcaacgaaaaagattgaagatactttgatttgtgggcagcggcagaaaatcgtattacattcg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39461220 |
cacagctaggtgttggttgttttcattcacccaaatttcaacgaaaaagattgaagatactttgatttgtgggcagcggcagcaaatcgtattacattcg |
39461121 |
T |
 |
| Q |
203 |
tcttggttgcaagcttgatggg |
224 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
39461120 |
tcttggttgcaagcttgatggg |
39461099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 8e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 71 - 143
Target Start/End: Original strand, 34329794 - 34329866
Alignment:
| Q |
71 |
tttcattccaatccattcaaatttatcaatttcacagctaggtgttggttgttttcattcacccaaatttcaa |
143 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
34329794 |
tttcattctgatccattcaaatttatcaatttcacagtgagaggttggttgttttcattcacccaaatttcaa |
34329866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University