View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13295_high_33 (Length: 373)
Name: NF13295_high_33
Description: NF13295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13295_high_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 342; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 15 - 364
Target Start/End: Original strand, 42280276 - 42280625
Alignment:
| Q |
15 |
aacaacaacacaaggttttgactcccttggagctagatgccagcagtattacaaagctggagcgcggtttgccaagtggcgtgcggtcctcaagattggt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42280276 |
aacaacaacacaaggttttgactcccttggagctagatgccagcagtattacaaagctggagcgcggtttgccaagtggcgtgcggtcctcaagattggt |
42280375 |
T |
 |
| Q |
115 |
cccaatgagccctctgagttgtctatccagcaaaatgcacagggcttggctcgctacgccatcatttgccaggagaatggccttgtgcctattgttgagc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42280376 |
cccaatgagccctctgagttgtctatccagcaaaatgcacagggcttggctcgctacgccatcatttgccaggagaatggccttgtgcctattgttgagc |
42280475 |
T |
 |
| Q |
215 |
ctgagattttaaccgatggatctcatgacatcgccaaatgcgccgctgtcactgaaactgtgcttgcagctgtttacaaggcactgaatgatcagcatgt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42280476 |
ctgagattttaaccgatggatctcatgacatcgccaaatgcgccgctgtcactgaaactgtacttgcagctgtttacaaggcactgaatgatcagcatgt |
42280575 |
T |
 |
| Q |
315 |
ccttcttgaaggaactcttctcaagcctaacatggttaccacaggttctg |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42280576 |
ccttcttgaaggaactcttctcaagcctaacatggttaccccaggttctg |
42280625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 289 - 354
Target Start/End: Complemental strand, 29237364 - 29237299
Alignment:
| Q |
289 |
tacaaggcactgaatgatcagcatgtccttcttgaaggaactcttctcaagcctaacatggttacc |
354 |
Q |
| |
|
|||||||| ||||||| || |||||||| |||||||| ||||| | |||||||||||||||||| |
|
|
| T |
29237364 |
tacaaggccttgaatgaccaccatgtcctccttgaaggcactctcttgaagcctaacatggttacc |
29237299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University