View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13295_high_51 (Length: 273)
Name: NF13295_high_51
Description: NF13295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13295_high_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 41344058 - 41343803
Alignment:
| Q |
1 |
gaatgagagctattcttggagagtcctccaacaaatggatacgaaaagtgaggatcattatgtaataagcaattcaaaggttgcagctacttgcatgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41344058 |
gaatgagagctattcttggagagtcctccaacaaatggatacgaaaagtgaggatcattatgtaataagcaattcaaaggttgcagctacttgcatgttg |
41343959 |
T |
 |
| Q |
101 |
atggaagaagcttttgggatgataacagacaaacatactggcgtcaatgtggtacaaagtgttttatacaaccgcaggtaagcacttcttagtcctaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41343958 |
atggaagaagcttttgggatgataacagacaaacatactggcgtcaatgtggtacaaagtgttttatacaaccgcaggtaagcacttcttagtcctaata |
41343859 |
T |
 |
| Q |
201 |
caaactctttttattagtagtattattcataatattcttctacttatatataatac |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41343858 |
caaactctttttattagtagtattattcataatattcttctacttatatataatac |
41343803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University