View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13295_high_61 (Length: 243)
Name: NF13295_high_61
Description: NF13295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13295_high_61 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 5 - 243
Target Start/End: Original strand, 48797252 - 48797490
Alignment:
| Q |
5 |
atgaatggccatgtttcatcatccgttgctcaaaagaataggtagagataataaggaacaaggattgcaatttgactgttacaataacttacttcatcaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48797252 |
atgaatggccatgtttcatcatccgttgctcaaaagaataggtagagataataaggaataaggattgcaatttgactgttacaataacttacttcatcaa |
48797351 |
T |
|
| Q |
105 |
ccatggcacttgctcaagctcaatcctctgcttctcttcctgtctctcttcgaggtaacccgttattctcaagtctcaaccctctgttccatttctattg |
204 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48797352 |
ccatggcacttgctcaagctcaaccctctgcttctcttcctgtctctcttcgaggtaacccgttattctcaagtctcaaccctctgttccatttctattg |
48797451 |
T |
|
| Q |
205 |
tagcactcaatttaactatattacctgtgttgcagatgc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48797452 |
tagcactcaatttaactatattacctgtgttgcagatgc |
48797490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University