View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13295_high_63 (Length: 238)
Name: NF13295_high_63
Description: NF13295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13295_high_63 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 37308089 - 37308307
Alignment:
| Q |
1 |
tttttccgtcattcaaactcaatgcgtacgaatgctggaaattttgtacatagaagatgacttttcttttttactaaacacacgagaggacttaaatttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37308089 |
tttttccgtcattcaaactcaatgcgtacgaatgctggaaattttgtacatagaagatgacttttcttttttactaaacacacgagaggacttaaatttc |
37308188 |
T |
 |
| Q |
101 |
agtgtgacggggtgtgtagacttaccaaataccaatcagaagacaactgattttgaagattgcaccattcaacattttgcaaagccggtggaggctctta |
200 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37308189 |
agtgtgacgaggtgtgtagacttacc-aataccaatcagaagacaactgattttgaagattgcaccattcaacattttgcaaagccggtggagcctctta |
37308287 |
T |
 |
| Q |
201 |
ttggtaataagcttgtagttggt |
223 |
Q |
| |
|
|||| |||||||||||||||| |
|
|
| T |
37308288 |
ttgg---taagcttgtagttggt |
37308307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University