View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13295_high_68 (Length: 232)
Name: NF13295_high_68
Description: NF13295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13295_high_68 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 21 - 201
Target Start/End: Original strand, 7943832 - 7944002
Alignment:
| Q |
21 |
aggggctgaagatggagtttggctggagggaggatttggatatgtttggattttagatgtaaccatcaccattccattaaactggggtaaggtaaggtaa |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7943832 |
aggggctgaagatggagtttggctggagggaggatttggatatgtttggattttagatgtaaccatcaccattccattaaactgg----------ggtaa |
7943921 |
T |
|
| Q |
121 |
ggtaaggtatgctatactatattctagatatctttcttataagattttattaaaaataattgtatctattttttatactat |
201 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7943922 |
ggtaaggtatgctatactatattccagatatctttgttataagattttattaaaaataattgtatctattttttatactat |
7944002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University