View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13295_low_35 (Length: 370)
Name: NF13295_low_35
Description: NF13295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13295_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 18 - 88
Target Start/End: Original strand, 41825532 - 41825602
Alignment:
| Q |
18 |
aggtaggtgcaaattttttgatgtcagggtatgcaaatgcatcccctcaattcaatgtggctccgccactg |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41825532 |
aggtaggtgcaaattttttgatgtcagggtatgcaagtgcatcccctcaattcaatgtggctccgccactg |
41825602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 59; Significance: 6e-25; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 18 - 88
Target Start/End: Original strand, 31808363 - 31808433
Alignment:
| Q |
18 |
aggtaggtgcaaattttttgatgtcagggtatgcaaatgcatcccctcaattcaatgtggctccgccactg |
88 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
31808363 |
aggtaggtgcaaattttttgatgtcagggaatgcaagtgcatcccctcaatttaatgtggctccgccactg |
31808433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 18 - 88
Target Start/End: Original strand, 50537332 - 50537402
Alignment:
| Q |
18 |
aggtaggtgcaaattttttgatgtcagggtatgcaaatgcatcccctcaattcaatgtggctccgccactg |
88 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
50537332 |
aggtatgtgcaatattttagatgtcagggtatgcaattgcatcccctcaagtcaatgtggctccgccactg |
50537402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University