View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13295_low_35 (Length: 370)

Name: NF13295_low_35
Description: NF13295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13295_low_35
NF13295_low_35
[»] chr3 (1 HSPs)
chr3 (18-88)||(41825532-41825602)
[»] chr1 (2 HSPs)
chr1 (18-88)||(31808363-31808433)
chr1 (18-88)||(50537332-50537402)


Alignment Details
Target: chr3 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 18 - 88
Target Start/End: Original strand, 41825532 - 41825602
Alignment:
18 aggtaggtgcaaattttttgatgtcagggtatgcaaatgcatcccctcaattcaatgtggctccgccactg 88  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
41825532 aggtaggtgcaaattttttgatgtcagggtatgcaagtgcatcccctcaattcaatgtggctccgccactg 41825602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 59; Significance: 6e-25; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 18 - 88
Target Start/End: Original strand, 31808363 - 31808433
Alignment:
18 aggtaggtgcaaattttttgatgtcagggtatgcaaatgcatcccctcaattcaatgtggctccgccactg 88  Q
    ||||||||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||||||||||||    
31808363 aggtaggtgcaaattttttgatgtcagggaatgcaagtgcatcccctcaatttaatgtggctccgccactg 31808433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 18 - 88
Target Start/End: Original strand, 50537332 - 50537402
Alignment:
18 aggtaggtgcaaattttttgatgtcagggtatgcaaatgcatcccctcaattcaatgtggctccgccactg 88  Q
    ||||| ||||||  |||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||    
50537332 aggtatgtgcaatattttagatgtcagggtatgcaattgcatcccctcaagtcaatgtggctccgccactg 50537402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University