View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13295_low_37 (Length: 348)
Name: NF13295_low_37
Description: NF13295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13295_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 68 - 332
Target Start/End: Original strand, 50117695 - 50117959
Alignment:
| Q |
68 |
tatattgatatggaagaggcatatgattggttcatatagaggttttctttaagattttagtgaaaaaagcctagaagtagaaaggagatcagaactttga |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50117695 |
tatattgatatggaagaggcatatgattggttcatatagaggttttctttaagattttagtgaaaaaagcctagaagtagaaaggagatcagaactttga |
50117794 |
T |
 |
| Q |
168 |
attgcttatatgttctatctaaccagttgaataagatagtacaatacaaggggatcatgactagccagtagcgtgaaagtacagtgtgaaggatacaaat |
267 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50117795 |
attgcttatatgttatatctaaccagttgaataagatagtacaatacaaggggatcatgactagccagtagcgtgaaagtacagtgtgaaggatacaaat |
50117894 |
T |
 |
| Q |
268 |
ggtttccctataactaaaggtttgcatgaaaagtgaactttttcaatttatctatggtagaaaat |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50117895 |
ggtttccctataactaaaggtttgcatgaaaagtgaactttttcgatttatctatggtagaaaat |
50117959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 12 - 73
Target Start/End: Original strand, 50117590 - 50117651
Alignment:
| Q |
12 |
aagaagcaaagtaaaggggataattgtcacaagttattttccaacatcagcatgcatatatt |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50117590 |
aagaagcaaagtaaaggggataattgtcacaagttattttccaacatcagcatgcatctatt |
50117651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University