View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13295_low_39 (Length: 331)
Name: NF13295_low_39
Description: NF13295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13295_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 326
Target Start/End: Original strand, 2946274 - 2946599
Alignment:
| Q |
1 |
acactcttacaaagtgaaacttcccttcccctctctcactgccttggtaattacaaagtcaaactctgatacatgcttttttataccaccctcacttccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2946274 |
acactcttacaaagtgaaacttcccttcccctctctcactgccttggtaattacaaagtcaaactctgatacatgcttttttataccaccctcacttccc |
2946373 |
T |
 |
| Q |
101 |
tagtaaggcaaactccagatcacagtttttaagtgactttaaattaagaggccgttattgttacttttgtggcttacgtaacaaaaatgttgcatttttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2946374 |
tagtaaggcaaactccagatcacagtttttaagtgactttaaattaagaggccgttattgttacttttgtggcttacgtaacaaaaatgttgcatttttg |
2946473 |
T |
 |
| Q |
201 |
tcttgaaaaatgtcgaataattgagatgtcaagtctaaatttctaccatgagtcttccttgcaggttttgtgttctaatatgtagttgtacattctgatt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2946474 |
tcttgaaaaatgtcgaataattgagatgtcaagtctaaatttctaccatgagtctttcttgcaggttttgtgttctaatatgtagttgtacattctgatt |
2946573 |
T |
 |
| Q |
301 |
cgtgcttcttttgatctttccctgtg |
326 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
2946574 |
cgtgcttcttttgatctttctctgtg |
2946599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University