View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13295_low_48 (Length: 281)
Name: NF13295_low_48
Description: NF13295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13295_low_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 48797807 - 48798000
Alignment:
| Q |
19 |
atatcttatataaaaaataaatgatctataattttatctcattctattgcaaaatctgcatattcatatagacgaaaagattagtatttgactatttgtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48797807 |
atatcttatataaaaaataaatgatctataattttatctcattctattgcaaaatctgcatattcatatagacgaaaagattagtatt--------tgtg |
48797898 |
T |
 |
| Q |
119 |
ttataagctaaagcttcttaatttagatagaccgagctaatttgaagcaactgtgagaaatggtagtgctaatgctcatactatttgaaaatattgatac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48797899 |
ttataagctaaagcttcttaatttagatagaccgagctaatttgaagcaagtgtcagaaatggtagtgctaatgctcatactatctgaaaatattgatac |
48797998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University