View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13295_low_50 (Length: 275)
Name: NF13295_low_50
Description: NF13295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13295_low_50 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 13213698 - 13213954
Alignment:
| Q |
1 |
tggggggttagaagaatttgggtttactttgttttttgttgggttagggttaggtccaaggaatcggatcgatgatgggtttgatattggtaagaaagac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13213698 |
tggggggttagaagaatttgggtttactttgttttttgttgggttagggttaggtccaaggaatcggatcgatgatgggtttgatattggtaagaaagac |
13213797 |
T |
|
| Q |
101 |
agcgtgcgcatgggcggtgttgtgggacctacaaagtgggtcccatttattcaagactactaccatgcttgaaatttctctctc-cttataactagtgtc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13213798 |
agcgtgcgcatgggcggtgttgtgggacctacaaagtgggtcccatatattcaa---tactaccatgcttgaaatttctctctctcttataactagtgtc |
13213894 |
T |
|
| Q |
200 |
tttgtaaatgtttgtgtatgtgtaagtttcttcttctatattggaaaagctgcaaataag |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13213895 |
tttgtaaatgtttgtgtatgtgtaagtttcttcttctatattggaaaagctgcaaataag |
13213954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University