View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13295_low_60 (Length: 243)
Name: NF13295_low_60
Description: NF13295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13295_low_60 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 141 - 243
Target Start/End: Original strand, 33854179 - 33854281
Alignment:
| Q |
141 |
tacaaatatacttattttacttagccgaacgtaccattattgtatcaatagttaatttttaagagtgagtagggaccattgttaattgacatcaatccta |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33854179 |
tacaaatatacttattttacttagccgaacgtaccattattgtatcaatagttaatttttaagagtgagtagggaccattgttaattgacatcaatccta |
33854278 |
T |
|
| Q |
241 |
ctt |
243 |
Q |
| |
|
||| |
|
|
| T |
33854279 |
ctt |
33854281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 18 - 94
Target Start/End: Original strand, 33854103 - 33854180
Alignment:
| Q |
18 |
atatactacttaatatctgtggtatgtaatctactcttatattaagggaa-gtgggagtattctttatcaattagata |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33854103 |
atatactacttaatatctgtggtatgtaatctactcttatattaagggaaggtgggagtattctttatcaattagata |
33854180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 214
Target Start/End: Original strand, 33854896 - 33854930
Alignment:
| Q |
180 |
ttgtatcaatagttaatttttaagagtgagtaggg |
214 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33854896 |
ttgtaccaatagttaatttttaagagtgagtaggg |
33854930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University