View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13295_low_62 (Length: 239)
Name: NF13295_low_62
Description: NF13295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13295_low_62 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 116 - 223
Target Start/End: Original strand, 47524351 - 47524458
Alignment:
| Q |
116 |
aatagataaccaaccatttatgttttgctgtgatcaccattccatcatagtttgaattgtagtgttaaatactatgatcaattgatcatattgatactga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47524351 |
aatagataaccaaccatttatgttttgctgtgatcaccattccatcatagtttgaattgtagtgttaaatactatgatcaattgatcatattgatactga |
47524450 |
T |
 |
| Q |
216 |
catcattt |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
47524451 |
catcattt |
47524458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 47524236 - 47524286
Alignment:
| Q |
1 |
aaaatgtctttgatggtatagtttcttttagacatgtttttaatgatgtac |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47524236 |
aaaatgtctttgatggtatagtttcttttagacatgtttttaatgatgtac |
47524286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 208
Target Start/End: Complemental strand, 44870004 - 44869960
Alignment:
| Q |
164 |
agtttgaattgtagtgttaaatactatgatcaattgatcatattg |
208 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
44870004 |
agtttaaattgtagtgttaaatactatgatcaatagaccatattg |
44869960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University